| p-value: | 1e-6 |
| log p-value: | -1.435e+01 |
| Information Content per bp: | 1.528 |
| Number of Target Sequences with motif | 240.0 |
| Percentage of Target Sequences with motif | 38.22% |
| Number of Background Sequences with motif | 12310.4 |
| Percentage of Background Sequences with motif | 29.11% |
| Average Position of motif in Targets | 405.0 +/- 334.2bp |
| Average Position of motif in Background | 391.3 +/- 358.1bp |
| Strand Bias (log2 ratio + to - strand density) | -0.2 |
| Multiplicity (# of sites on avg that occur together) | 1.30 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
MA0164.1_Nr2e3/Jaspar
| Match Rank: | 1 |
| Score: | 0.58 |
| Offset: | 1 |
| Orientation: | reverse strand |
| Alignment: | GATGCTTT -AAGCTTG |
|

|
|
POL008.1_DCE_S_I/Jaspar
| Match Rank: | 2 |
| Score: | 0.57 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -GATGCTTT NGAAGC--- |
|

|
|
Atf4(bZIP)/MEF-Atf4-ChIP-Seq(GSE35681)/Homer
| Match Rank: | 3 |
| Score: | 0.56 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --GATGCTTT MTGATGCAAT |
|

|
|
Mouse_Recombination_Hotspot(Zf)/Testis-DMC1-ChIP-Seq(GSE24438)/Homer
| Match Rank: | 4 |
| Score: | 0.56 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------GATGCTTT ACTYKNATTCGTGNTACTTC |
|

|
|
Chop(bZIP)/MEF-Chop-ChIP-Seq(GSE35681)/Homer
| Match Rank: | 5 |
| Score: | 0.54 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --GATGCTTT ATGATGCAAT |
|

|
|
PH0037.1_Hdx/Jaspar
| Match Rank: | 6 |
| Score: | 0.53 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---GATGCTTT------ TNNNATGATTTCNNCNN |
|

|
|
PB0125.1_Gata3_2/Jaspar
| Match Rank: | 7 |
| Score: | 0.53 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------GATGCTTT------- TTTTGTAGATTTTATCGACTTA |
|

|
|
PB0203.1_Zfp691_2/Jaspar
| Match Rank: | 8 |
| Score: | 0.53 |
| Offset: | -7 |
| Orientation: | reverse strand |
| Alignment: | -------GATGCTTT-- NTNNNAGGAGTCTCNTN |
|

|
|
PRDM9(Zf)/Testis-DMC1-ChIP-Seq(GSE35498)/Homer
| Match Rank: | 9 |
| Score: | 0.52 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -GATGCTTT------ AGATGCTRCTRCCHT |
|

|
|
PH0125.1_Obox5_2/Jaspar
| Match Rank: | 10 |
| Score: | 0.52 |
| Offset: | -6 |
| Orientation: | reverse strand |
| Alignment: | ------GATGCTTT--- NANAGGGATTAATTATN |
|

|
|