| p-value: | 1e-4 |
| log p-value: | -1.040e+01 |
| Information Content per bp: | 1.963 |
| Number of Target Sequences with motif | 7.0 |
| Percentage of Target Sequences with motif | 11.48% |
| Number of Background Sequences with motif | 480.6 |
| Percentage of Background Sequences with motif | 1.46% |
| Average Position of motif in Targets | 94.1 +/- 56.1bp |
| Average Position of motif in Background | 100.5 +/- 91.5bp |
| Strand Bias (log2 ratio + to - strand density) | 1.6 |
| Multiplicity (# of sites on avg that occur together) | 1.14 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
NFATC1/MA0624.1/Jaspar
| Match Rank: | 1 |
| Score: | 0.77 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TTGGAAAC- NNTGGAAANN |
|
|
|
NFATC2/MA0152.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.76 |
| Offset: | 1 |
| Orientation: | reverse strand |
| Alignment: | TTGGAAAC -TGGAAAA |
|
|
|
NFAT(RHD)/Jurkat-NFATC1-ChIP-Seq(Jolma_et_al.)/Homer
| Match Rank: | 3 |
| Score: | 0.76 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TTGGAAAC- AATGGAAAAT |
|
|
|
NFATC3/MA0625.1/Jaspar
| Match Rank: | 4 |
| Score: | 0.75 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TTGGAAAC- AATGGAAAAT |
|
|
|
NFAT5/MA0606.1/Jaspar
| Match Rank: | 5 |
| Score: | 0.74 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TTGGAAAC- NATGGAAAAN |
|
|
|
PB0160.1_Rfxdc2_2/Jaspar
| Match Rank: | 6 |
| Score: | 0.73 |
| Offset: | -4 |
| Orientation: | forward strand |
| Alignment: | ----TTGGAAAC----- CTACTTGGATACGGAAT |
|
|
|
CHR(?)/Hela-CellCycle-Expression/Homer
| Match Rank: | 7 |
| Score: | 0.72 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | TTGGAAAC-- TTTGAAACCG |
|
|
|
PB0158.1_Rfx3_2/Jaspar
| Match Rank: | 8 |
| Score: | 0.69 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------TTGGAAAC------- ACTGACCCTTGGTTACCACAAAG |
|
|
|
RBPJ/MA1116.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.66 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --TTGGAAAC CCTGGGAAAG |
|
|
|
NFIA/MA0670.1/Jaspar
| Match Rank: | 10 |
| Score: | 0.66 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --TTGGAAAC NNTTGGCANN |
|
|
|