| p-value: | 1e-3 |
| log p-value: | -7.870e+00 |
| Information Content per bp: | 1.966 |
| Number of Target Sequences with motif | 11.0 |
| Percentage of Target Sequences with motif | 1.72% |
| Number of Background Sequences with motif | 239.3 |
| Percentage of Background Sequences with motif | 0.49% |
| Average Position of motif in Targets | 79.0 +/- 43.8bp |
| Average Position of motif in Background | 96.7 +/- 55.0bp |
| Strand Bias (log2 ratio + to - strand density) | 0.8 |
| Multiplicity (# of sites on avg that occur together) | 1.27 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
ZNF354C/MA0130.1/Jaspar
| Match Rank: | 1 |
| Score: | 0.79 |
| Offset: | 1 |
| Orientation: | reverse strand |
| Alignment: | CGTGGAGG -GTGGAT- |
|
|
|
GLIS1/MA0735.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.67 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----CGTGGAGG---- GCTTCGTGGGGGGTCT |
|
|
|
PB0111.1_Bhlhb2_2/Jaspar
| Match Rank: | 3 |
| Score: | 0.67 |
| Offset: | -10 |
| Orientation: | forward strand |
| Alignment: | ----------CGTGGAGG----- TGTCATTACACGTGGAAGGCGGT |
|
|
|
MXI1/MA1108.1/Jaspar
| Match Rank: | 4 |
| Score: | 0.65 |
| Offset: | -5 |
| Orientation: | reverse strand |
| Alignment: | -----CGTGGAGG NNGCACGTGGNNN |
|
|
|
ARNT::HIF1A/MA0259.1/Jaspar
| Match Rank: | 5 |
| Score: | 0.65 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---CGTGGAGG GGACGTGC--- |
|
|
|
Ahr::Arnt/MA0006.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.64 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --CGTGGAGG TGCGTG---- |
|
|
|
MYC/MA0147.3/Jaspar
| Match Rank: | 7 |
| Score: | 0.64 |
| Offset: | -5 |
| Orientation: | reverse strand |
| Alignment: | -----CGTGGAGG NNGCACGTGGNN- |
|
|
|
GLIS3/MA0737.1/Jaspar
| Match Rank: | 8 |
| Score: | 0.64 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---CGTGGAGG--- CTTCGTGGGGGGTC |
|
|
|
Hes1/MA1099.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.63 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----CGTGGAGG NNCGCGTGNN-- |
|
|
|
Creb3l2/MA0608.1/Jaspar
| Match Rank: | 10 |
| Score: | 0.63 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---CGTGGAGG ACACGTGGC-- |
|
|
|