| p-value: | 1e-2 |
| log p-value: | -4.644e+00 |
| Information Content per bp: | 1.466 |
| Number of Target Sequences with motif | 605.0 |
| Percentage of Target Sequences with motif | 29.21% |
| Number of Background Sequences with motif | 12889.8 |
| Percentage of Background Sequences with motif | 26.89% |
| Average Position of motif in Targets | 99.6 +/- 57.9bp |
| Average Position of motif in Background | 99.9 +/- 54.8bp |
| Strand Bias (log2 ratio + to - strand density) | 0.0 |
| Multiplicity (# of sites on avg that occur together) | 1.64 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
PB0179.1_Sp100_2/Jaspar
| Match Rank: | 1 |
| Score: | 0.73 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | CGCGTCGA------- TCCGTCGCTTAAAAG |
|
|
|
POL006.1_BREu/Jaspar
| Match Rank: | 2 |
| Score: | 0.56 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --CGCGTCGA AGCGCGCC-- |
|
|
|
ARNT::HIF1A/MA0259.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.56 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CGCGTCGA GCACGTNC- |
|
|
|
PB0111.1_Bhlhb2_2/Jaspar
| Match Rank: | 4 |
| Score: | 0.55 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------CGCGTCGA------- TGTCATTACACGTGGAAGGCGGT |
|
|
|
Ahr::Arnt/MA0006.1/Jaspar
| Match Rank: | 5 |
| Score: | 0.55 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | CGCGTCGA TGCGTG-- |
|
|
|
ZNF354C/MA0130.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.55 |
| Offset: | 3 |
| Orientation: | reverse strand |
| Alignment: | CGCGTCGA- ---GTGGAT |
|
|
|
Creb3l2/MA0608.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.54 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CGCGTCGA ACACGTGGC |
|
|
|
PB0199.1_Zfp161_2/Jaspar
| Match Rank: | 8 |
| Score: | 0.54 |
| Offset: | -8 |
| Orientation: | reverse strand |
| Alignment: | --------CGCGTCGA NNGCNCTGCGCGGC-- |
|
|
|
HIF1A/MA1106.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.53 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---CGCGTCGA NNGCACGTNC- |
|
|
|
PB0112.1_E2F2_2/Jaspar
| Match Rank: | 10 |
| Score: | 0.53 |
| Offset: | -6 |
| Orientation: | reverse strand |
| Alignment: | ------CGCGTCGA--- NNNNTTGGCGCCGANNN |
|
|
|