| p-value: | 1e-7 |
| log p-value: | -1.691e+01 |
| Information Content per bp: | 1.872 |
| Number of Target Sequences with motif | 155.0 |
| Percentage of Target Sequences with motif | 11.81% |
| Number of Background Sequences with motif | 3605.6 |
| Percentage of Background Sequences with motif | 7.58% |
| Average Position of motif in Targets | 101.6 +/- 59.1bp |
| Average Position of motif in Background | 103.0 +/- 64.4bp |
| Strand Bias (log2 ratio + to - strand density) | -0.3 |
| Multiplicity (# of sites on avg that occur together) | 1.01 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
ZNF354C/MA0130.1/Jaspar
| Match Rank: | 1 |
| Score: | 0.63 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -TTCACCGT ATCCAC--- |
|
|
|
ZNF652/HepG2-ZNF652.Flag-ChIP-Seq(Encode)/Homer
| Match Rank: | 2 |
| Score: | 0.63 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | TTCACCGT------- TTAACCCTTTVNKKN |
|
|
|
MZF1(var.2)/MA0057.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.62 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | TTCACCGT-- TTCCCCCTAC |
|
|
|
PRDM1(Zf)/Hela-PRDM1-ChIP-Seq(GSE31477)/Homer
| Match Rank: | 4 |
| Score: | 0.61 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---TTCACCGT- ACTTTCACTTTC |
|
|
|
RELB/MA1117.1/Jaspar
| Match Rank: | 5 |
| Score: | 0.61 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---TTCACCGT GAATTCCCCGG |
|
|
|
POL002.1_INR/Jaspar
| Match Rank: | 6 |
| Score: | 0.60 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | TTCACCGT- -TCAGTCTT |
|
|
|
MZF1/MA0056.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.59 |
| Offset: | 1 |
| Orientation: | reverse strand |
| Alignment: | TTCACCGT -TCCCCA- |
|
|
|
SA0003.1_at_AC_acceptor/Jaspar
| Match Rank: | 8 |
| Score: | 0.59 |
| Offset: | -12 |
| Orientation: | forward strand |
| Alignment: | ------------TTCACCGT CCTTTACCCTTCTTCACCTT |
|
|
|
NR2F2/MA1111.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.58 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TTCACCGT-- NNTGACCTTTN |
|
|
|
PB0045.1_Myb_1/Jaspar
| Match Rank: | 10 |
| Score: | 0.57 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---TTCACCGT------ ATGGAAACCGTTATTTT |
|
|
|