| p-value: | 1e-49 |
| log p-value: | -1.129e+02 |
| Information Content per bp: | 1.775 |
| Number of Target Sequences with motif | 396.0 |
| Percentage of Target Sequences with motif | 3.05% |
| Number of Background Sequences with motif | 412.0 |
| Percentage of Background Sequences with motif | 1.32% |
| Average Position of motif in Targets | 98.8 +/- 56.8bp |
| Average Position of motif in Background | 100.5 +/- 62.7bp |
| Strand Bias (log2 ratio + to - strand density) | 0.2 |
| Multiplicity (# of sites on avg that occur together) | 1.16 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
PB0036.1_Irf6_1/Jaspar
| Match Rank: | 1 |
| Score: | 0.59 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----TMKATTCG----- NNNTTGGTTTCGNTNNN |
|

|
|
PH0044.1_Homez/Jaspar
| Match Rank: | 2 |
| Score: | 0.58 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -TMKATTCG-------- AAAACATCGTTTTTAAG |
|

|
|
PB0035.1_Irf5_1/Jaspar
| Match Rank: | 3 |
| Score: | 0.57 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TMKATTCG------ NTGGTTTCGGTTNNN |
|

|
|
PB0034.1_Irf4_1/Jaspar
| Match Rank: | 4 |
| Score: | 0.56 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --TMKATTCG----- TNTGGTTTCGATACN |
|

|
|
Foxh1(Forkhead)/hESC-FOXH1-ChIP-Seq(GSE29422)/Homer
| Match Rank: | 5 |
| Score: | 0.55 |
| Offset: | -4 |
| Orientation: | forward strand |
| Alignment: | ----TMKATTCG NNTGTGGATTSS |
|

|
|
POL008.1_DCE_S_I/Jaspar
| Match Rank: | 6 |
| Score: | 0.54 |
| Offset: | 2 |
| Orientation: | forward strand |
| Alignment: | TMKATTCG --GCTTCC |
|

|
|
PB0125.1_Gata3_2/Jaspar
| Match Rank: | 7 |
| Score: | 0.54 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------TMKATTCG----- TTTTGTAGATTTTATCGACTTA |
|

|
|
MA0479.1_FOXH1/Jaspar
| Match Rank: | 8 |
| Score: | 0.54 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --TMKATTCG- TGTGGATTNNN |
|

|
|
PB0185.1_Tcf1_2/Jaspar
| Match Rank: | 9 |
| Score: | 0.53 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | TMKATTCG------ NNTAATCCNGNCNN |
|

|
|
PH0057.1_Hoxb13/Jaspar
| Match Rank: | 10 |
| Score: | 0.53 |
| Offset: | -5 |
| Orientation: | reverse strand |
| Alignment: | -----TMKATTCG--- NNAATTTTATTGGNTN |
|

|
|