| p-value: | 1e0 |
| log p-value: | -0.000e+00 |
| Information Content per bp: | 1.530 |
| Number of Target Sequences with motif | 247.0 |
| Percentage of Target Sequences with motif | 47.41% |
| Number of Background Sequences with motif | 270.2 |
| Percentage of Background Sequences with motif | 74.04% |
| Average Position of motif in Targets | 159.0 +/- 22.5bp |
| Average Position of motif in Background | 3477973.0 +/- 3516787.3bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
POL013.1_MED-1/Jaspar
| Match Rank: | 1 |
| Score: | 0.78 |
| Offset: | 2 |
| Orientation: | forward strand |
| Alignment: | TAGCTCCC --GCTCCG |
|
|
|
AFT2/AFT2_H2O2Lo/10-RCS1[~AFT2](Harbison)/Yeast
| Match Rank: | 2 |
| Score: | 0.67 |
| Offset: | 2 |
| Orientation: | reverse strand |
| Alignment: | TAGCTCCC --GCACCC |
|
|
|
GCR2(MacIsaac)/Yeast
| Match Rank: | 3 |
| Score: | 0.65 |
| Offset: | 2 |
| Orientation: | forward strand |
| Alignment: | TAGCTCCC- --GCTTCCN |
|
|
|
ZNF16/MA1654.1/Jaspar
| Match Rank: | 4 |
| Score: | 0.64 |
| Offset: | -11 |
| Orientation: | reverse strand |
| Alignment: | -----------TAGCTCCC---- AAAACCTTCCATGGCTCCCTATT |
|
|
|
SNT2/SNT2_YPD/[](Harbison)/Yeast
| Match Rank: | 5 |
| Score: | 0.64 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---TAGCTCCC TGGTAGCGCCG |
|
|
|
GCR2/MA0305.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.63 |
| Offset: | 2 |
| Orientation: | forward strand |
| Alignment: | TAGCTCCC- --GCTTCCT |
|
|
|
SNT2/MA0384.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.63 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---TAGCTCCC TGGTAGCGCCG |
|
|
|
MAC1/Literature(Harbison)/Yeast
| Match Rank: | 8 |
| Score: | 0.62 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TAGCTCCC TTTGCTC-- |
|
|
|
UME6/UME6_YPD/51-UME6(Harbison)/Yeast
| Match Rank: | 9 |
| Score: | 0.62 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | TAGCTCCC-- TAGCCGCCGA |
|
|
|
POL010.1_DCE_S_III/Jaspar
| Match Rank: | 10 |
| Score: | 0.61 |
| Offset: | 1 |
| Orientation: | reverse strand |
| Alignment: | TAGCTCCC -NGCTN-- |
|
|
|