| p-value: | 1e0 |
| log p-value: | -0.000e+00 |
| Information Content per bp: | 1.530 |
| Number of Target Sequences with motif | 168.0 |
| Percentage of Target Sequences with motif | 37.75% |
| Number of Background Sequences with motif | 233.2 |
| Percentage of Background Sequences with motif | 58.37% |
| Average Position of motif in Targets | 240.1 +/- 39.1bp |
| Average Position of motif in Background | 2841315.0 +/- 3910382.5bp |
| Strand Bias (log2 ratio + to - strand density) | 10.0 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
TOD6/MA0350.1/Jaspar
| Match Rank: | 1 |
| Score: | 0.81 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------GTCATCGC----- AGGCACAGCTCATCGCGTTTT |
|
|
|
CHA4(MacIsaac)/Yeast
| Match Rank: | 2 |
| Score: | 0.81 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | GTCATCGC- CTCATCGCA |
|
|
|
DOT6/MA0351.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.80 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------GTCATCGC----- TTCTGCACCTCATCGCATCCT |
|
|
|
TOD6?/SacCer-Promoters/Homer
| Match Rank: | 4 |
| Score: | 0.76 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --GTCATCGC AKCTCATCGC |
|
|
|
ZNF669(Zf)/HEK293-ZNF669.GFP-ChIP-Seq(GSE58341)/Homer
| Match Rank: | 5 |
| Score: | 0.73 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----GTCATCGC-- GARTGGTCATCGCCC |
|
|
|
WRKY45/MA1087.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.73 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -GTCATCGC GGTCAACG- |
|
|
|
WRKY30/MA1083.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.73 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -GTCATCGC- GGTCAACGCT |
|
|
|
WRKY46(WRKY)/colamp-WRKY46-DAP-Seq(GSE60143)/Homer
| Match Rank: | 8 |
| Score: | 0.73 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---GTCATCGC- AAAGTCAACGSN |
|
|
|
WRKY42(WRKY)/colamp-WRKY42-DAP-Seq(GSE60143)/Homer
| Match Rank: | 9 |
| Score: | 0.72 |
| Offset: | -4 |
| Orientation: | forward strand |
| Alignment: | ----GTCATCGC NAAAGTCAACGN |
|
|
|
RBP1-LIKE(RRM)/Drosophila_melanogaster-RNCMPT00127-PBM/HughesRNA
| Match Rank: | 10 |
| Score: | 0.72 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | GTCATCGC ATCAACG- |
|
|
|