| p-value: | 1e-81 |
| log p-value: | -1.871e+02 |
| Information Content per bp: | 1.802 |
| Number of Target Sequences with motif | 2012.0 |
| Percentage of Target Sequences with motif | 6.26% |
| Number of Background Sequences with motif | 1221.9 |
| Percentage of Background Sequences with motif | 4.00% |
| Average Position of motif in Targets | 101.6 +/- 56.5bp |
| Average Position of motif in Background | 97.3 +/- 72.8bp |
| Strand Bias (log2 ratio + to - strand density) | 0.1 |
| Multiplicity (# of sites on avg that occur together) | 1.03 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
POL010.1_DCE_S_III/Jaspar
| Match Rank: | 1 |
| Score: | 0.71 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | GGCTGCGT NGCTN--- |
|
|
|
Smad3(MAD)/NPC-Smad3-ChIP-Seq(GSE36673)/Homer
| Match Rank: | 2 |
| Score: | 0.70 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --GGCTGCGT TWGTCTGV-- |
|
|
|
POL009.1_DCE_S_II/Jaspar
| Match Rank: | 3 |
| Score: | 0.68 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | GGCTGCGT -GCTGTG- |
|
|
|
ZFP42/MA1651.1/Jaspar
| Match Rank: | 4 |
| Score: | 0.62 |
| Offset: | -10 |
| Orientation: | forward strand |
| Alignment: | ----------GGCTGCGT--- GTTCCAAAATGGCTGCCTCCG |
|
|
|
POL013.1_MED-1/Jaspar
| Match Rank: | 5 |
| Score: | 0.62 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | GGCTGCGT -GCTCCG- |
|
|
|
MAFK/MA0496.3/Jaspar
| Match Rank: | 6 |
| Score: | 0.62 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --GGCTGCGT----- NNTGCTGAGTCAGCN |
|
|
|
POL008.1_DCE_S_I/Jaspar
| Match Rank: | 7 |
| Score: | 0.61 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | GGCTGCGT -GCTTCC- |
|
|
|
Smad4(MAD)/ESC-SMAD4-ChIP-Seq(GSE29422)/Homer
| Match Rank: | 8 |
| Score: | 0.60 |
| Offset: | -4 |
| Orientation: | forward strand |
| Alignment: | ----GGCTGCGT VBSYGTCTGG-- |
|
|
|
Smad2(MAD)/ES-SMAD2-ChIP-Seq(GSE29422)/Homer
| Match Rank: | 9 |
| Score: | 0.60 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --GGCTGCGT CTGTCTGG-- |
|
|
|
POL006.1_BREu/Jaspar
| Match Rank: | 10 |
| Score: | 0.59 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | GGCTGCGT GGCGCGCT |
|
|
|