| p-value: | 1e-8 |
| log p-value: | -1.922e+01 |
| Information Content per bp: | 1.939 |
| Number of Target Sequences with motif | 120.0 |
| Percentage of Target Sequences with motif | 2.98% |
| Number of Background Sequences with motif | 736.1 |
| Percentage of Background Sequences with motif | 1.68% |
| Average Position of motif in Targets | 93.0 +/- 52.1bp |
| Average Position of motif in Background | 99.6 +/- 61.4bp |
| Strand Bias (log2 ratio + to - strand density) | -0.7 |
| Multiplicity (# of sites on avg that occur together) | 1.15 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
ZKSCAN5/MA1652.1/Jaspar
| Match Rank: | 1 |
| Score: | 0.77 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---GGAAGGGA--- GGAGGAGGTGAGAA |
|
|
|
PU.1-IRF(ETS:IRF)/Bcell-PU.1-ChIP-Seq(GSE21512)/Homer
| Match Rank: | 2 |
| Score: | 0.74 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -GGAAGGGA--- CGGAAGTGAAAC |
|
|
|
MAZ/MA1522.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.74 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --GGAAGGGA- GGGGAGGGGNN |
|
|
|
ZNF189(Zf)/HEK293-ZNF189.GFP-ChIP-Seq(GSE58341)/Homer
| Match Rank: | 4 |
| Score: | 0.74 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -GGAAGGGA- TGGAACAGMA |
|
|
|
ETV4/MA0764.2/Jaspar
| Match Rank: | 5 |
| Score: | 0.71 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---GGAAGGGA ACAGGAAGTG- |
|
|
|
SPIB/MA0081.2/Jaspar
| Match Rank: | 6 |
| Score: | 0.71 |
| Offset: | -6 |
| Orientation: | reverse strand |
| Alignment: | ------GGAAGGGA-- NAAAGAGGAAGTGANA |
|
|
|
ZNF467(Zf)/HEK293-ZNF467.GFP-ChIP-Seq(GSE58341)/Homer
| Match Rank: | 7 |
| Score: | 0.71 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---GGAAGGGA- TGGGGAAGGGCM |
|
|
|
PU.1:IRF8(ETS:IRF)/pDC-Irf8-ChIP-Seq(GSE66899)/Homer
| Match Rank: | 8 |
| Score: | 0.70 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | GGAAGGGA---- GGAAGTGAAAST |
|
|
|
ETV5/MA0765.2/Jaspar
| Match Rank: | 9 |
| Score: | 0.70 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---GGAAGGGA NCCGGAAGTNN |
|
|
|
SPI1/MA0080.5/Jaspar
| Match Rank: | 10 |
| Score: | 0.70 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------GGAAGGGA---- AAAAAAGAGGAAGTGAAAAA |
|
|
|